Journal: Cell reports. Medicine

Article Title: Interferon-γ-stimulated antigen-presenting cancer-associated fibroblasts hinder neoadjuvant chemoimmunotherapy efficacy in lung cancer.

doi: 10.1016/j.xcrm.2025.102017

Figure Lengend Snippet: Figure 6. Disruption of the JAK1/2-STAT1-IFI6/27-PD-L2 axis in apCAFs to compromise FOXP1+Tregs (A) Diagram of mechanism of IFN-g on apCAFs. (B) The protein expression levels of JAK-STAT pathway. Data are representative of three independent experiments. (C) Heatmap showing the mRNA expression level for genes from JAK-STAT pathway assessed by RT-qPCR. Each specific column means a specific patient’s CAF cell line. For every gene, the difference between any two treatment groups is significant, determined by two-way ANOVA test. (D) Representative ICC pictures of IFI6/27, p-STAT1, and p-JAK1 pathway. Scale bar, 50 mm. (E) Tumor growth curves: tumor cells + apCAFs + anti-PD1 (light blue), tumor cells (light gray), tumor + apCAFs (gray), tumor + anti-PD1 (navy blue), tumor + apCAFs + anti-PD-L2 (pink), and tumor + apCAFs + anti-PD1 + anti-PD-L2 (magenta). Individual and mean tumor volume over time. n = 5 mice per group, representative of three independent experiments. (F) The tumor photos of mice in (E). n = 4 mice per group.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER T cell subsets from human PBMC-bulk-RNA Itahashi et al., 202234 GEO: GSE211044 RNA-seq for 27 NSCLC patients treated with anti-PD-1/PD-L1 Jung et al., 201925 GEO: GSE135222 Experimental models: Cell lines Human: A549 SIBCB (Shanghai, China) Cat# SCSP-503 Human: HFL1 SIBCB (Shanghai, China) Cat# SCSP-5049 Mouse: LLC SIBCB (Shanghai, China) Cat# SCSP-5252 Mouse: MF iCell Bioscience (Shanghai, China) Cat# iCell-0033a Mouse: KP Gift from Dr. Deng N/A Mouse: SJT1601 Gift from Prof. Deng N/A Experimental models: Organisms/strains Mouse: C57BL/6J Shanghai Model Organisms (Shanghai, China) N/A Oligonucleotides RT-qPCR primer sequences, see Table S7 This paper N/A siRNA targeting sequence for IFI6: GCAGCGUCGUCAUAGGUAATT UUACCUAUGACGACGCUGCTT Obio Technology (Shanghai, China) N/A siRNA targeting sequence for IFI27: GGCCAGGAUUGCUACAGUUTT AACUGUAGCAAUCCUGGCCTT Obio Technology (Shanghai, China) N/A Negative control siRNA sequence: UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT Obio Technology (Shanghai, China) N/A shRNA targeting sequence for Ifngr: GCCAGAGTTAAAGCTAAGGTT Genepharma (Shanghai, China) N/A Software and algorithms ImageJ National Institutes of Health https://imagej.net/ij/ SlideViewer The Digital Pathology Company https://www.3dhistech.com/ research/software-downloads/ BioRender NA https://biorender.com/ GraphPad Prism version 9.5.0 GraphPad Software https://www.graphpad.com/ Gepia2 Zefang Tang, Tianxiang Chen, Chenwei Li and Boxi Kang of Zhang Lab, Peking University. http://gepia2.cancer-pku.cn FlowJo version 10.8.1 FlowJo https://www.flowjo.com R version 4.4.1 The R Foundation https://www.r-project.org/ OPEN ACCESS

Techniques: Disruption, Expressing, Quantitative RT-PCR